Generation of macrophages with altered viral sensitivity from genome-edited rhesus macaque iPSCs to model human disease
نویسندگان
چکیده
Because of their close biological similarity to humans, non-human primate (NHP) models are very useful for the development induced pluripotent stem cell (iPSC)-based and regenerative organ transplantation therapies. However, knowledge on establishment, differentiation, genetic modification NHP-iPSCs, especially rhesus macaque iPSCs, is limited. We succeeded in establishing iPSCs from peripheral blood macaques (Rh-iPSCs) by combining Yamanaka reprograming factors two inhibitors (GSK-3 inhibitor [CHIR 99021] MEK1/2 [PD0325901]) differentiated cells into functional macrophages through hematopoietic progenitor cells. To confirm feasibility Rh-iPSC-derived as a platform bioassays model diseases, we knocked out TRIM5 gene Rh-iPSCs CRISPR-Cas9, which species-specific HIV resistance factor. knockout (KO) had same differentiation potential did Rh-iPSCs, but showed gain sensitivity infection vitro. Our reprogramming, editing, protocols used obtain can be applied other mutations, expanding number NHP therapy models. Induced (iPSCs) expected have many clinical applications medicine because unlimited self-renewal ability differentiate any type or tissue.1Takahashi K. Tanabe Ohnuki M. Narita Ichisaka T. Tomoda S. Induction adult human fibroblasts defined factors.Cell. 2007; 131: 861-872Abstract Full Text PDF PubMed Scopus (13713) Google Scholar Several groups, including ours, preparing mature differentiating them cells, lymphocytes, with aim treating wide variety cancer viral infections.2Nishimura Kaneko Kawana-Tachikawa A. Tajima Y. Goto H. Zhu D. Nakayama-Hosoya Iriguchi Uemura Shimizu et al.Generation rejuvenated antigen-specific T reprogramming pluripotency redifferentiation.Cell Stem Cell. 2013; 12: 114-126Abstract (220) Scholar, 3Vizcardo R. Masuda Yamada Ikawa Fujii Koseki Kawamoto Regeneration tumor derived CD8+ cells.Cell 31-36Abstract (183) 4Ando Nishimura Yamazaki Yamaguchi Hayama Nakauchi Ando J. Ota Takahashi al.A safeguard system cell-derived therapy.Stem Cell Reports. 2015; 5: 597-608Abstract (44) In addition, an ideal perform engineering such genome editing technology transduction, genomic integrity edited thoroughly assessed due high cloning efficiency. The utility iPSC-based further augmented when combined engineering. fact, possibility treatment transfected short hairpin RNA (shRNA) targeting promotor has been reported.5Higaki Hirao Kumagai Ueda N. Bo W. Kamibayashi Watanabe HIV-resistant IPSCs using transcriptional silencing promoter-targeted RNA.Mol. Ther. Nucleic Acids. 2018; 793-804Abstract (5) Functional immune at iPSC stage also reported.6Xu Wang B. Ono Kagita Sasakawa Gee P. Nishikawa Nomura al.Targeted disruption HLA genes via CRISPR-Cas9 generates enhanced compatibility.Cell 2019; 24: 566-578.e7Abstract (140) 7Minagawa Yoshikawa Yasukawa Hotta Kunitomo Takiguchi Kassai Imai E. Yasui al.Enhancing receptor stability iPSC-derived improves use immunotherapy.Cell 23: 850-858.e4Abstract (53) 8Kang Minder Park M.A. Mesquitta W.T. Torbett B.E. Slukvin I.I. CCR5 CRISPR/Cas9 provides selective CCR5-tropic HIV-1 virus.Mol. 4: e268Abstract (84) vivo evaluation efficacy safety, tumorigenicity immunogenicity preclinical models, essential application products, most studies evaluated safety immunodeficient mice only. Non-human preferred animal stronger similarities between NHPs humans compared humans. Accordingly, NHP-iPSCs retinal disease, Parkinson’s heart hereditary bone disease reported, production myocardial allogeneic transplantation.9Kamao Mandai Okamoto Sakai Suga Sugita Kiryu Characterization pigment epithelium sheets aiming application.Stem 2014; 2: 205-218Abstract (409) 10Hallett P.J. Deleidi Astradsson Smith G.A. Cooper O. Osborn T.M. Sundberg Moore Perez-Torres Brownell A.L. al.Successful function autologous dopamine neurons following disease.Cell 16: 269-274Abstract (187) 11Lin Liu Klein Ostrominski Hong S.G. Yada R.C. Chen G. Navarengom Schwartzbeck San al.Efficient cardiomyocytes generation calcium-sensor reporter lines nonhuman iPSCs.Sci. Rep. 8: 5907Crossref (12) 12Hong Winkler Wu C. Guo V. Pittaluga Nicolae Donahue R.E. Metzger M.E. Price S.D. Uchida al.Path clinic: Assessment therapies model.Cell 7: 1298-1309Abstract (65) 13Shiba Gomibuchi Seto Wada Ichimura Tanaka Ogasawara Okada Shiba Sakamoto al.Allogeneic iPS regenerates hearts.Nature. 2016; 538: 388-391Crossref (365) phylogenetically size, lifespan, system.12Hong Scholar,14Hong Lin Dunbar C.E. Zou role therapies.Mol. 1165-1169Abstract (10) Scholar,15Estes J.D. Wong S.W. Brenchley J.M. Nonhuman infections.Nat. Rev. Immunol. 18: 390-404Crossref Additionally, adaptive innate responses antigens similar those Among NHPs, (Rh) suitable immunological analysis, investigating infections transplantations, major histocompatibility complexes (MHCs) analyzed detail.16de Groot Doxiadis G.G. Otting de Vos-Rouweler A.J. Bontrop Differential recombination dynamics within MHC species.Immunogenetics. 66: 535-544Crossref (11) 17Doxiadis Bolijn M.J. Heijmans C.M. N.G. van der Wiel M.K. Remarque E.J. Vangenot al.Haplotype diversity generated ancient recombination-like events Indian macaques.Immunogenetics. 65: 569-584Crossref (36) 18Hansen H.L. Burwitz B.J. Hughes Hammond K.B. Ventura A.B. Reed J.S. Gilbride R.M. Ainslie Morrow D.W. al.Broadly targeted restricted complex E.Science. 351: 714-720Crossref (182) reprogrammed Rh may tools studying vitro vivo. resemble terms morphology, marker expression, growth factor dependency.19Liu F. Yong Zhang Hou Li Jiang Cai Cui monkey fibroblasts.Cell 2008; 3: 587-590Abstract (378) this study, proof concept loss gene-edited system. TRIM5α known Rh.20Stremlau Owens Perron Kiessling Autissier Sodroski cytoplasmic body component restricts Old World monkeys.Nature. 2004; 427: 848-853Crossref (1461) 21Nakayama E.E. Miyoshi Nagai Shioda A specific region 37 amino acid residues SPRY (B30.2) domain African green determines restriction simian immunodeficiency virus SIVmac infection.J. Virol. 2005; 79: 8870-8877Crossref (112) 22Ganser-Pornillos B.K. Pornillos Restriction retroviruses TRIM5.Nat. Microbiol. 17: 546-556Crossref (39) It reported that CD4 lymphocytes lost TALEN.23Wang X. Yu Q. Yuan Teng Z. Zeng Targeting enhance susceptibility CD4+ infection.Arch. 2017; 162: 793-798Crossref (2) wild-type KO (HPCs) functions, finding products HIV. techniques presented paper will contribute HPC transplantation24Hütter Nowak Mossner Ganepola Müssig Allers Schneider Hofmann Kücherer Blau al.Long-term control delta32/delta32 stem-cell transplantation.N. Engl. Med. 2009; 360: 692-698Crossref (1227) Scholar,25Gupta R.K. Abdul-Jawad McCoy L.E. Mok H.P. Peppa Salgado Martinez-Picado Nijhuis Wensing A.M.J. Lee al.HIV-1 remission CCR5Δ32/Δ32 haematopoietic transplantation.Nature. 568: 244-248Crossref (221) transplantations leukocyte antigen (HLA)-KO iPSCs.26Riolobos L. Hirata Turtle C.J. P.-R. Gornalusse Zavajlevski Riddell S.R. Russell cells.Mol. 21: 1232-1241Abstract (137) established fibroblasts, marrow stromal CD34+ stem/progenitor (HSPCs),11Lin Scholar,12Hong Scholar,19Liu Scholar,27Fang Zhao Du Xiang Miao naive 15: 488-497Abstract (81) 28D’Souza S.S. Maufort Kumar Smuga-Otto Thomson J.A. GSK3β inhibition promotes efficient myeloid lymphoid hematopoiesis primate-induced cells.Stem 6: 243-256Abstract (17) 29Hong Choi Carpentier Liang T.J. Merling Sweeney C.L. Malech Jung Corat M.A.F. al.Rhesus safe harbor gene-editing stable expression transgenes all germ layers.Mol. 25: 44-53Abstract not mononuclear (PBMCs), become mainstream viewpoints invasiveness, sterility, ease collection iPSCs.2Nishimura Scholar,3Vizcardo Scholar,7Minagawa protocol PBMCs Sendai (SeV) vector encoding (OCT3/4, SOX2, KLF4, c-MYC)30Nishimura Sano Ohtaka Furuta Umemura Nakajima Ikehara Kobayashi Segawa Takayasu al.Development defective persistent vector: unique delivery/expression reprogramming.J. Biol. Chem. 2011; 286: 4760-4771Abstract (225) establish Rh-iPSCs. Notably, no colonies were observed medium basic fibroblast (bFGF), typically reprogram was reprogramming. Therefore, 2i medium, adds GSK-3 (CHIR 99021) (PD0325901)31Ying Q.-L. Wray Nicholas Batlle-Morera Doble Woodgett Cohen ground state embryonic self-renewal.Nature. 453: 519-523Crossref (2343) original maintenance medium. case, dome-shaped about 25–30 days after transfection (Figures 1A 1B ). confirmed three (animal IDs: R1863, R1887, R1889) (Figure 1C). Residual SeV detected one Rh-iPSC clone prepared individual, remaining clones 1D). expressed Nanog, POU5F1, c-Myc RT-PCR, SSEA4, undifferentiated fluorescence-activated sorting (FACS) 1E 1F). verified detecting teratoma could layers 1G). Finally, maintained more than 50 passages normal karyotype 1H). By applying protocol2Nishimura Scholar,5Higaki 2A), 2B 2C). improve efficiency induction, added BMP4, promote mesoderm differentiation,32Lengerke Schmitt Bowman T.V. Jang I.H. Maouche-Chretien McKinney-Freeman Davidson Hammerschmidt Rentzsch Green J.B.A. al.BMP Wnt specify fate activation Cdx-Hox pathway.Cell 72-82Abstract (164) 33Woods N.B. Parker A.S. Moraghebi Lutz Firth Brennand K.J. Berggren Raya Izpisúa Belmonte J.C. Gage F.H. Verma I.M. Brief report: Efficient precursors progenitors lines.Stem Cells. 29: 1158-1164Crossref (60) 34Gori J.L. Chandrasekaran Kowalski J.P. Adair J.E. Beard B.C. D’Souza S.L. Kiem H.-P. generation, purification, expansion cells.Blood. 2012; 120: e35-e44Crossref (28) day 0 2D). Table 1 shows summary colony-forming unit (CFU) assay performed evaluate whether represent HPCs. containing CFU-M (macrophage), CFU-GM (granulocyte-macrophage), CFU-G (granulocyte), CFU-E (erythroid) 0.6% 2E). These results indicate multipotential HPCs.Table 1Summary (confluent 6-cm dish)Total (×106)CD34+ (%)CD34+ (×106)R1863#78.69 ± 0.10731.467 5.1472.63 0.009R1887#115.07 0.3025.567 3.13.92 0.110R1889#318.91 0.85623.267 6.7163.48 0.068Data shown mean SE independent experiments. Open table new tab Data Next, HPCs macrophages, target HIV/SIV (simian virus), method our group.5Higaki After co-cultured C3H10T1/2 feeder 10 presence macrophage colony-stimulating (M-CSF) granulocyte-macrophage CSF (GM-CSF), adherent seeded low-adsorption plate cultured 3A). Starting confluent dish, 1–2 × 107 obtained 34. 34, obvious growth. FACS analysis CD11b+/CD14+/CD68+/CD86+/CD163−. They CCR5, co-receptor 3B S1A). phenotypes resembled monocyte-derived S1B). phagocytosis h co-culturing Alexa Fluor 594-conjugated Escherichia coli bioparticles 3C). stimulated lipopolysaccharide (LPS) produced inflammatory cytokines necrosis (TNF) interleukin (IL)-6 3D). SIV infection. Macrophage tropic SIVmac316 SIVmac239 p27 protein measured ELISA 1, 4, 7. co-culture suggest protocol. next edit Rh. PRYSPRY its C-terminal connected long link N-terminal, includes motifs: RING domain, B-box 2 coiled-coil domain. Candidate sequences single guide (sgRNA) selected CRISPOR (http://crispor.tefor.net/crispor.py). sequence Figure 4A. sgRNA Cas9 electroporation picked up 24 manually without drug selection. An revealed mutations 7 clones, 3 showing homozygous 4B). in-frame mutation allele. randomly selecting heterozygous performing additional able create TRIM5αKO stop codon frameshift 4C). considered important controlling infection.21Nakayama existed exon3 downstream translated. Thus, When mRNA qPCR, level decreased strains, caused nonsense mutation-dependent degradation (NMD)35Garneau N.L. Wilusz highways byways decay.Nat. Mol. 113-126Crossref (880) Scholar,36Lykke-Andersen Jensen T.H. Nonsense-mediated decay: intricate machinery shapes transcriptomes.Nat. 665-677Crossref (376) 4D). reference parental Parental equivalent efficiencies 4E 4F). levels CD86 different TRIM5αKO. One report found dendritic (DCs) lacking TRIM5α-mediated retroviral upregulate expression.37Portilho D.M. Fernandez Ringeard Machado A.K. Boulay Mayer Müller-Trutwin Beignon Kirchhoff Nisole Arhel N.J. Endogenous regulated SUMOylation nuclear sequestration sensing 14: 355-369Abstract (23) hypothesize increased mechanism. off-target sites RNAs (gRNAs), identified software Sanger sequencing (Table 2). From these results, compromise potential.Table 2Results top five candidates determined CFD score gRNAPositionSequence (5′→3′)No. mismatchesCFD scoreKO #1KO #2KO #3TRIM5 on-target sitechr14:67658119–110054350CTACGACAAAACCAACGTCT CGG–1.0000−14 bp, −14 bp−5 bp−14 bpPotential siteschr4:103904324–103904346CTATAATAAAACCAACATCT TGG40.525778WTWTWTchr2:76073316–76073338CTAAGGCAAAAACAACATCT AGG40.401003WTWTWTchr2:98763243–98763265CTGCCACAAACCCAACATCT TGG40.179259WTWTWTchr7:42594298–42594320ATAAGATAAAACCAACGTCT GAG30.177388WTWTWTchr9:104127964–104127986CTACAAAGAAACCAACTTCT AGG40.119167WTWTWTCFD, cutting frequency determination; WT, wild-type. CFD, order functionally infected (vesicular stomatitis glycoprotein G [VSV-G]-pseudotyped lentivirus expressing luciferase [NL43-Luci/VSV-G]38Taya Nakayama Moderate macrophage-tropic SAMHD1 macrophages.PLoS ONE. 9: e90969Crossref (4) Scholar). (NL43-Luci/VSV-G) Luminescence (2, 3, 4), suggesting early 5A). determine TRIM5α, degrades reverse transcription stage, tested transcriptase (nevirapine [NVP]), it suppressed 5B). possible TRIM5. As first step creating evaluating genome-edited generate PBMCs, induce HPCs/macrophages, concept, deleted adding (PD0325901) (i.e., 2i) collected aseptically relatively easily. originally maintain mouse (ESCs),31Ying since
منابع مشابه
Evolutionary and Biomedical Insights from the Rhesus Macaque Genome
www.sciencemag.org (this information is current as of December 2, 2007 ): The following resources related to this article are available online at http://www.sciencemag.org/cgi/content/full/316/5822/222 version of this article at: including high-resolution figures, can be found in the online Updated information and services, http://www.sciencemag.org/cgi/content/full/316/5822/222/DC1 can be foun...
متن کاملEvolutionary and Biomedical Insights from the Rhesus Macaque Genome
www.sciencemag.org (this information is current as of April 13, 2007 ): The following resources related to this article are available online at http://www.sciencemag.org/cgi/content/full/316/5822/222 version of this article at: including high-resolution figures, can be found in the online Updated information and services, http://www.sciencemag.org/cgi/content/full/316/5822/222/DC1 can be found ...
متن کاملEvolutionary and Biomedical Insights from the Rhesus Macaque Genome
The rhesus macaque (Macaca mulatta) is an abundant primate species that diverged from the ancestors of Homo sapiens about 25 million years ago. Because they are genetically and physiologically similar to humans, rhesus monkeys are the most widely used nonhuman primate in basic and applied biomedical research. We determined the genome sequence of an Indian-origin Macaca mulatta female and compar...
متن کاملEvolutionary and Biomedical Insights from the Rhesus Macaque Genome
The rhesus macaque (Macaca mulatta) is an abundant primate species that diverged from the ancestors of Homo sapiens about 25 million years ago. Because they are genetically and physiologically similar to humans, rhesus monkeys are the most widely used nonhuman primate in basic and applied biomedical research. We determined the genome sequence of an Indian-origin Macaca mulatta female and compar...
متن کاملEvolutionary and Biomedical Insights from the Rhesus Macaque Genome
The rhesus macaque (Macaca mulatta) is an abundant primate species that diverged from the ancestors of Homo sapiens about 25 million years ago. Because they are genetically and physiologically similar to humans, rhesus monkeys are the most widely used nonhuman primate in basic and applied biomedical research. We determined the genome sequence of an Indian-origin Macaca mulatta female and compar...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
ژورنال
عنوان ژورنال: Molecular therapy. Methods & clinical development
سال: 2021
ISSN: ['2329-0501']
DOI: https://doi.org/10.1016/j.omtm.2021.03.008